STRINGSTRING
BPSL0408 BPSL0408 BPSL0805 BPSL0805 BPSS1239 BPSS1239 BPSL2104 BPSL2104 mrcA mrcA BPSS0238 BPSS0238 BPSS2304 BPSS2304 BPSL0409 BPSL0409 BPSL0410 BPSL0410 secB secB mtgA mtgA
Nodes:
Network nodes represent proteins
splice isoforms or post-translational modifications are collapsed, i.e. each node represents all the proteins produced by a single, protein-coding gene locus.
Node Color
colored nodes:
query proteins and first shell of interactors
white nodes:
second shell of interactors
Node Content
empty nodes:
proteins of unknown 3D structure
filled nodes:
a 3D structure is known or predicted
Edges:
Edges represent protein-protein associations
associations are meant to be specific and meaningful, i.e. proteins jointly contribute to a shared function; this does not necessarily mean they are physically binding to each other.
Known Interactions
from curated databases
experimentally determined
Predicted Interactions
gene neighborhood
gene fusions
gene co-occurrence
Others
textmining
co-expression
protein homology
Your Input:
Neighborhood
Gene Fusion
Cooccurrence
Coexpression
Experiments
Databases
Textmining
[Homology]
Score
BPSL0408Similar to Escherichia coli penicillin-binding protein 6 precursor DacC SWALL:DACC_ECOLI (SWALL:P08506) (400 aa) fasta scores: E(): 5.8e-48, 42.21% id in 379 aa, and to Ralstonia solanacearum probable penicillin-binding rsc0327 or rs03294 SWALL:Q8Y2K8 (EMBL:AL646058) (397 aa) fasta scores: E(): 1.8e-79, 58.8% id in 403 aa; Belongs to the peptidase S11 family. (403 aa)    
Predicted Functional Partners:
BPSL0805
Family S13 unassigned peptidase; Weakly similar to Escherichia coli penicillin-binding protein 4 precursor DacB or b3182 SWALL:PBP4_ECOLI (SWALL:P24228) (477 aa) fasta scores: E(): 2.3e-23, 26.06% id in 422 aa. Similar to Ralstonia solanacearum probable D-alanyl-D-alanine carboxypeptidase signal peptide protein rsc0584 or rs04879 SWALL:Q8Y1V5 (EMBL:AL646060) (514 aa) fasta scores: E(): 1.3e-86, 54.25% id in 494 aa; Downstream repeat region (cggcgagggaaacggcgagggaaacggcgagggaaa)3.
     
 0.915
BPSS1239
Family S11 unassigned peptidase; Similar to Pseudomonas putida D-alanyl-D-alanine carboxypeptidase DacA or pp4803 SWALL:AAN70372 (EMBL:AE016792) (386 aa) fasta scores: E(): 3.1e-33, 42.75% id in 276 aa, and to Ralstonia solanacearum probable penicillin-binding Dac or rsc0327 or rs03294 SWALL:Q8Y2K8 (EMBL:AL646058) (397 aa) fasta scores: E(): 4.4e-45, 44.87% id in 312 aa, and to Xanthomonas axonopodis penicillin-binding protein 6 DacC or xac0664 SWALL:Q8PPM2 (EMBL:AE011695) (401 aa) fasta scores: E(): 1.2e-33, 38.8% id in 268 aa; Belongs to the peptidase S11 family.
  
  
 
0.909
BPSL2104
Putative penicillin-binding protein; Similar to Ralstonia solanacearum probable penicillin-binding 1 rsc2976 or rs01357 SWALL:Q8XV55 (EMBL:AL646073) (801 aa) fasta scores: E(): 2.2e-183, 61.61% id in 805 aa, and to Neisseria lactamica penicillin-binding protein 1A MrcA or PonA SWALL:PBPA_NEILA (SWALL:O87579) (798 aa) fasta scores: E(): 4.3e-129, 47.4% id in 791 aa. Note: This CDS is longer in its N-terminal region than most of its database matches.
     
 0.904
mrcA
Similar to Escherichia coli penicillin-binding protein 1A MrcA or PonA or b3396 SWALL:PBPA_ECOLI (SWALL:P02918) (850 aa) fasta scores: E(): 1.9e-88, 38.63% id in 818 aa.
     
 0.904
BPSS0238
Similar to Bacillus subtilis penicillin-binding protein 1A/1B PonA SWALL:PBPA_BACSU (SWALL:P39793) (914 aa) fasta scores: E(): 8.7e-44, 30.94% id in 685 aa, and to Escherichia coli penicillin-binding protein 1B MrcB or PonB or PbpF or b0149 SWALL:PBPB_ECOLI (SWALL:P02919) (844 aa) fasta scores: E(): 9.3e-43, 31.98% id in 591 aa.
     
 0.904
BPSS2304
Penicillin-binding protein; Internal region is similar to an internal region of Escherichia coli penicillin-binding protein 1A MrcA or PonA SWALL:PBPA_ECOLI (SWALL:P02918) (850 aa) fasta scores: E(): 1.4e-21, 30.8% id in 737 aa. C-terminal region is similar to Chlorobium tepidum penicillin-binding protein 1 CT0176 SWALL:AAM71424 (EMBL:AE012797) (763 aa) fasta scores: E(): 1.5e-58, 36.31% id in 771 aa.
     
 0.904
BPSL0409
Putative D-amino acid aminotransferase; Similar to Bacillus licheniformis D-alanine aminotransferase Dat SWALL:DAAA_BACLI (SWALL:P54692) (283 aa) fasta scores: E(): 8.7e-28, 40.42% id in 282 aa, and to Listeria innocua D-alanine aminotransferase lin1660 SWALL:DAAA_LISIN (SWALL:Q92B90) (289 aa) fasta scores: E(): 1.8e-27, 36.74% id in 283 aa.
 
     0.637
BPSL0410
Similar to Ralstonia solanacearum hypothetical protein rsc0326 or rs03293 SWALL:Q8Y2K9 (EMBL:AL646058) (97 aa) fasta scores: E(): 4.2e-17, 53.92% id in 102 aa, and to Neisseria meningitidis hypothetical protein nma1380 or nmb1218 SWALL:Q9JRI4 (EMBL:AL162755) (91 aa) fasta scores: E(): 3.9e-15, 54.11% id in 85 aa; Belongs to the UPF0250 family.
  
    0.607
secB
Protein-export protein; One of the proteins required for the normal export of preproteins out of the cell cytoplasm. It is a molecular chaperone that binds to a subset of precursor proteins, maintaining them in a translocation-competent state. It also specifically binds to its receptor SecA.
  
     0.558
mtgA
Putative peptidoglycan biosynthesis-related protein; Peptidoglycan polymerase that catalyzes glycan chain elongation from lipid-linked precursors; Belongs to the glycosyltransferase 51 family.
  
 
 0.554
Your Current Organism:
Burkholderia pseudomallei
NCBI taxonomy Id: 272560
Other names: B. pseudomallei K96243, Burkholderia pseudomallei K96243, Burkholderia pseudomallei str. K96243, Burkholderia pseudomallei strain K96243
Server load: low (24%) [HD]
STRING is a Core Data Resource as designated by Global Biodata Coalition and ELIXIR.