STRINGSTRING
BPSS0963 BPSS0963 BPSS0962 BPSS0962 tufA2 tufA2 tufA1 tufA1 BPSS0736 BPSS0736 hemF hemF BPSL0804 BPSL0804 BPSL2322 BPSL2322
Nodes:
Network nodes represent proteins
splice isoforms or post-translational modifications are collapsed, i.e. each node represents all the proteins produced by a single, protein-coding gene locus.
Node Color
colored nodes:
query proteins and first shell of interactors
white nodes:
second shell of interactors
Node Content
empty nodes:
proteins of unknown 3D structure
filled nodes:
a 3D structure is known or predicted
Edges:
Edges represent protein-protein associations
associations are meant to be specific and meaningful, i.e. proteins jointly contribute to a shared function; this does not necessarily mean they are physically binding to each other.
Known Interactions
from curated databases
experimentally determined
Predicted Interactions
gene neighborhood
gene fusions
gene co-occurrence
Others
textmining
co-expression
protein homology
Your Input:
Neighborhood
Gene Fusion
Cooccurrence
Coexpression
Experiments
Databases
Textmining
[Homology]
Score
BPSS0963Hypothetical protein; No significant database matches. (228 aa)    
Predicted Functional Partners:
BPSS0962
Weakly similar to Serratia marcescens extracellular serine protease precursor SWALL:PRTT_SERMA (SWALL:P29805) (1045 aa) fasta scores: E(): 2.8e-32, 29.08% id in 1193 aa, and to Pseudomonas fluorescens serine protease homologue PspB SWALL:Q9ZNI5 (EMBL:AB015053) (1036 aa) fasta scores: E(): 8.4e-71, 36.9% id in 1176 aa. Autotransporter protein.
       0.642
tufA2
Elongation factor Tu; This protein promotes the GTP-dependent binding of aminoacyl- tRNA to the A-site of ribosomes during protein biosynthesis.
   
   0.564
tufA1
Elongation factor Tu; Similar to Escherichia coli elongation factor Tu SWALL:EFTU_ECOLI (SWALL:P02990) (393 aa) fasta scores: E(): 3.5e-122, 80.2% id in 394 aa.
   
   0.564
BPSS0736
Similar to Agrobacterium tumefaciens hypothetical protein ATU3055 or AGR_L_3502 SWALL:Q8UBG1 (EMBL:AE009236) (437 aa) fasta scores: E(): 2.3e-66, 45.56% id in 406 aa.
   
   0.564
hemF
Coproporphyrinogen III oxidase, aerobic; Involved in the heme biosynthesis. Catalyzes the aerobic oxidative decarboxylation of propionate groups of rings A and B of coproporphyrinogen-III to yield the vinyl groups in protoporphyrinogen- IX.
   
  
 0.448
BPSL0804
Putative membrane protein; Similar to Caulobacter crescentus hypothetical protein cc1444 SWALL:Q9A8B0 (EMBL:AE005819) (300 aa) fasta scores: E(): 6e-41, 40.79% id in 277 aa, and to Rhizobium loti hypothetical protein mll1065 SWALL:Q98LE0 (EMBL:AP002996) (317 aa) fasta scores: E(): 7.1e-40, 43.38% id in 272 aa; Upstream repeat region (cggcgagggaaacggcgagggaaacggcgagggaaa)3.
   
  
 0.406
BPSL2322
Putative membrane protein; Similar to Ralstonia solanacearum probable transmembrane protein rsc1254 or rs02770 SWALL:Q8XZZ1 (EMBL:AL646063) (324 aa) fasta scores: E(): 7.8e-63, 49.37% id in 318 aa. Weakly similar to Agrobacterium tumefaciens hypothetical protein atu0318 or AGR_C_556 SWALL:Q8UIH7 (EMBL:AE009003) (313 aa) fasta scores: E(): 2.3e-12, 28.57% id in 308 aa.
   
  
 0.406
Your Current Organism:
Burkholderia pseudomallei
NCBI taxonomy Id: 272560
Other names: B. pseudomallei K96243, Burkholderia pseudomallei K96243, Burkholderia pseudomallei str. K96243, Burkholderia pseudomallei strain K96243
Server load: low (26%) [HD]
STRING is a Core Data Resource as designated by Global Biodata Coalition and ELIXIR.